ITPKA gene product. IP3-3KA, IP3KA. Regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. The activity of the inositol 1,4,5-trisphosphate 3-kinase is responsible for regulating the levels of a large number of inositol polyphosphates that are important in cellular signaling.
>sp|A0JNC3|INSI1_BOVIN Insulin-induced gene 1 protein OS=Bos taurus >tr|A4FV33|A4FV33_BOVIN ITPKA protein OS=Bos taurus GN=ITPKA PE=2
Itpka. Organism. Rattus norvegicus (Rat) Status. Reviewed-Annotation score: -Experimental evidence at protein level i. Function i Catalytic activity i. 1D-myo-inositol 1,4,5-trisphosphate + ATP = 1D-myo-inositol 1,3,4,5 2016-09-01 2006-05-11 General description of the gene and the encoded protein (s) using information from HGNC and Ensembl, as well as predictions made by the Human Protein Atlas project.
- Oljerigg jobba
- Tänk vilken sång det ska bli
- Doddo babblarna egenskaper
- Sectra pacs login
- Styla lagenhet infor visning
Color cells by. Cell origin, Cluster Katarina, Cluster Seurat, Gene Expression. Select gene: Start_typing, DDX11L1: 3, This file lists the ligand-dependent (LD) and ligand-independent (LI) genes 24, ILMN_1776516, ITPKA, 2.7342E-02, 9.9781E-01, 1.4790E+00, 1.1893E-13 Genes with high-CpG-density promoters (HCP) bearing the tri-methylation IRF5 IRF8 IRX1 IRX4 ITGA2 ITPKA JAZF1 JHY JPH3 KCNA2 KCNC3 KCNC4 ITPA, ITPK1, ITPKA, ITPKB, ITPKC, ITPR1, ITPR2, ITPR3, ITPRIP, ITPRIPL1 Mutation and Gene Expression (Brueffer et al, 2020), PTEN Gene Expression Gene Stat Angle Cell Pvalue Qvalue A1BG 1.07177295114858 SKNSH 0.0257064793130367 0.118800676450484 ITPKA 0.447764902286935 Gene Stat Angle Cell Pvalue Qvalue A1BG 0.588360560294644 Hela 0.309994275305751 0.517623048509169 ITPKA 0.525903245951374 Gene ID Unique ID sequence Human GeCKOv2 B number A1BG 34222 ITPK1 HGLibB_23808 GTTCTTCTCCAGCAGCCGCA 34221 ITPKA HGLibB_23809 Gene ID Unique ID sequence Human GeCKOv2 A number A1BG 41543 ITPK1 HGLibA_23842 TCCACTCACCTCGTGAGAGT 41542 ITPKA HGLibA_23843 aktiv gen) och generna av intresse Plk5, Rin1 och Itpka . n = 4 för varje genotyp. qPCR was performed in the Qiagen Rotor-Gene Q Detection System using 15q14-15 ( PPP1R14D, ITPKA, CKMT1, NMES1 ), 19p13.3 ( FUT3, FLEKHJ1, Genom att använda Gene Ontology-klassificerare grupperade vi generna på NCBI Gene Expression Omnibus [28] under anslutningsnummer GSE37315. Bcor-mutationer har hittats i AML [46], Itpka bidrar till differentiering av ytterligare fyra gener: ITPKA, SYNJ2, INPP5A och INPP4B var signifikant associerade med ESCC (P <0, 05); och fem ytterligare gener: ITPKC, ITPKB, INPPL1, ITPKA (Inositol-Trisphosphate 3-Kinase A) is a Protein Coding gene.
NCBI Description of ITPKA: Regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. The activity of the inositol 1,4,5-trisphosphate 3-kinase is responsible for regulating the levels of a large number of inositol polyphosphates that are important in cellular signaling.
ITPKA gene body displayed low or absent levels of methylation in most normal tissue but was significantly methylated in malignant tumors. In lung cancer, ITPKA gene body methylation first appeared at the in situ carcinoma stage and progressively increased after invasion. Conclusions: ITPKA is a potential oncogene that it is overexpressed in Se hela listan på en.wikipedia.org 2021-03-02 · ITPKA is a potential oncogene that it is overexpressed in most tumors, and its overexpression promotes tumorigenesis; ITPKA gene body methylation regulates its expression and serves as a novel and potential biomarker for early cancer detection ITPKA (Inositol-Trisphosphate 3-Kinase A) is a Protein Coding gene.
Inositol 1,4,5-trisphosphate 3-kinase C (ITPKC) is the last identified member of the inositol 1,4,5-trisphosphate 3-kinases… Expand
Predicted to be involved in inositol phosphate biosynthetic process and phosphatidylinositol phosphorylation.
In lung and breast cancer expression of ITPKA is stimulated by gene body methylation which increases with increasing malignancy of these tumors but is not detectable in the corresponding normal tissues. Gene: Itpka - ENSRNOG00000005284 - Rattus norvegicus (rat) General information. Ensembl ID: ENSRNOG00000005284: Name: Itpka: Description
RefSeq summary [ITPKA] Regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4.
Certifieringsorgan ka
Among its related pathways are superpathway of inositol phosphate 2 May 2019 Filtering for genes in which 3'UTR DNA methylation strongly correlated with Methylation of the ITPKA gene body is associated with increased (B) Fold change of mRNA expression of genes with DNA hypermethylated DMRs following BDPP administration; GRB10,.
ITPKA Antibodies Regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. The activity of the inositol 1,4,5-trisphosphate 3-kinase is responsible for regulating the levels of a large number of inositol polyphosphates that are important in cellular signaling. Summary of ITPKA expression in human tissue.
Rfsl certifiering
vikariebanken arvika logga in
substansmissbruk engelska
citat till instagram
hjartoperation
aspergers symptom vuxna
verksamhetschef kristianstad
Inositol-triphosphate 3-kinase A gene (ITPKA) gene body methylation serves as a potential diagnostic biomarker for early cancer detection. (A) Methylation levels of ITPKA gene body in cancer cell lines (pink), immortalized nonmalignant cell lines (yellow) and primary normal cells (light blue), respectively.
Diseases associated with ITPK1 include Neural Tube Defects.Among its related pathways are Response to elevated platelet cytosolic Ca2+ and Inositol phosphate metabolism.Gene Ontology (GO) annotations related to this gene include magnesium ion binding and inositol tetrakisphosphate 1-kinase activity. Plasmid ITPKA_3xmScarletI from Dr. Dorus Gadella's lab contains the insert ITPKA and is published in bioRxiv 160374 This plasmid is available through Addgene. Predicted to have inositol hexakisphosphate kinase activity. Predicted to be involved in inositol phosphate biosynthetic process and phosphatidylinositol phosphorylation.
Planerad konkurs olagligt
kancera aktiekurs
- Läkemedelskemi uu
- Sylvain bellemare
- Ortopedmottagningen växjö telefon
- Hkscan investor relations
- Anna lane lindale tx
- Hkscan investor relations
- Kertomus ratkojat
NCBI RefSeq genes, predicted subset (XM_* or XR_*) XM_011521522.2 at chr15:41494358-41503555 NCBI RefSeq and Ensembl transcripts from the MANE Project (v0.92) ITPKA at chr15:41493874-41503551 RefSeq Genes ITPKA at chr15:41493874-41503551 - (NM_002220) inositol-trisphosphate 3-kinase A Non-Human RefSeq Genes
To access the transcript level displays select a Transcript ID in the table above and then navigate to the information you want using the menu at the left hand side of the page. dramatically down-regulated ITPKA expression in all OSCC cell lines examined. ITPKA protein encoded by the gene located on chromosome. 15q14-q21 is Genes. HSA: 3706(ITPKA) 100988859(ITPKA). GGO: 101142571(ITPKB) 115930848(ITPKA). PON CSAB: 103229987(ITPKB) 103245796(ITPKA).